View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12486_low_1 (Length: 315)
Name: NF12486_low_1
Description: NF12486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12486_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 169 - 311
Target Start/End: Complemental strand, 32184508 - 32184370
Alignment:
| Q |
169 |
taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggcaggcgagtgcttccatctcaactggattttctccacatgaaagatttagaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32184508 |
taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggc----gagtgcttccatctcaactggattttctccacatgaaggatttagaa |
32184413 |
T |
 |
| Q |
269 |
tcgaactcttgaccatttactgaaaatatgttagtccgttgct |
311 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||| ||||| |
|
|
| T |
32184412 |
tcgaactcttgaccatctacttaaaatatgttattcctttgct |
32184370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University