View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12487_high_9 (Length: 305)
Name: NF12487_high_9
Description: NF12487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12487_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 36097431 - 36097707
Alignment:
| Q |
18 |
gggacaaacatagtaaagtggtttagggattattagctgtatataatagaaggttcaaagggattatcaatgaaaggactttgcttctaggaagaagccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097431 |
gggacaaacatagtaaagtggtttagggattattagctgtatataatagaaggttcaaagggattatcaatgaaaggactttgcttctaggaagaagccg |
36097530 |
T |
 |
| Q |
118 |
agttttaatttaaagatggaatttttaaatgtgtggaacaaatgatcgaggctacgtttattctttgaaaagaaacataagctcaaattaaggaacatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097531 |
agttttaatttaaagatggaatttttaaatgtgtggaacaaatgatcgaggctacgtttattctttgaaaagaaacataagctcaaattaaggaacatca |
36097630 |
T |
 |
| Q |
218 |
aaagaacaaaag------acaacaagtaagttatttgaatgttgggacggacacgataaattttgggtagcaggagc |
288 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36097631 |
aaagaacaaaagacgtttacaacaagtaagttatttgaatgttgggacggacacgataaattttgggtagcaggagc |
36097707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University