View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12487_low_9 (Length: 329)
Name: NF12487_low_9
Description: NF12487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12487_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 12 - 171
Target Start/End: Complemental strand, 28759393 - 28759234
Alignment:
| Q |
12 |
agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759393 |
agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgttccatctgatggtggtgattggtgttttctgtctggttctgaat |
28759294 |
T |
|
| Q |
112 |
ctgatgattctgattggtctattgggtggttggagcctcttggttctgattttgaaagca |
171 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28759293 |
ctgatgactctgattggtctattgggtggctggagcctcttggttctgattttgaaagca |
28759234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 195 - 314
Target Start/End: Complemental strand, 28759213 - 28759094
Alignment:
| Q |
195 |
gattctggtggtgatagttttgctgttttggttccttgttattcacctggctgcaaggaaattgaaggttcaagcaatgtgcttttgaatgccatcaaga |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
28759213 |
gattctggtggtgatagttttgctgttttggttccttgttattcacctggctgcaaggagattgaaggctcaagcaatgtgcttttgaatgccattaaga |
28759114 |
T |
|
| Q |
295 |
acctccctagtgagttttct |
314 |
Q |
| |
|
||||||||| ||| |||||| |
|
|
| T |
28759113 |
acctccctaatgaattttct |
28759094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 13756748 - 13756613
Alignment:
| Q |
26 |
ggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgat |
125 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||| || || ||||||||||||||| | | ||||| || || |||||||||||||| || ||| |
|
|
| T |
13756748 |
ggaagagaggagagttgatagagagtatgatgttgttttagtatcatctgatggtggtggtggttgttta---tcaggctctgaatctgatgactcagat |
13756652 |
T |
|
| Q |
126 |
tggtctattgggtggttggagcctcttggttctgatttt |
164 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13756651 |
tggtctattgggtggttagagcctcatggttctgatttt |
13756613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 27969538 - 27969589
Alignment:
| Q |
99 |
tctggttctgaatctgatgattctgattggtctattgggtggttggagcctc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
27969538 |
tctggttctgaatctgatgattctgattggtcaattggatggttggaacctc |
27969589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 267
Target Start/End: Complemental strand, 13756580 - 13756522
Alignment:
| Q |
209 |
tagttttgctgttttggttccttgttattcacctggctgcaaggaaattgaaggttcaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| || ||||||||| ||||||| |||| |
|
|
| T |
13756580 |
tagttttgctgttttggttccttgttatagaccaggttgcaaggaagttgaaggctcaa |
13756522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 46047109 - 46047065
Alignment:
| Q |
106 |
ctgaatctgatgattctgattggtctattgggtggttggagcctc |
150 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||| |
|
|
| T |
46047109 |
ctgaatctgttgcttctgattggtctattggctggttggagcctc |
46047065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University