View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12489_high_5 (Length: 242)
Name: NF12489_high_5
Description: NF12489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12489_high_5 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 22773788 - 22773585
Alignment:
| Q |
17 |
cagagagtgaagagacaaatgaacacaagcaagggaatagcgtgaatcatcttattcaccgtcggtgatcgtgaccgggaaacgtctcttcttgcggcgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
22773788 |
cagagagtgaagagacaaatgaacacaagcaagggaatagcgtgaatcatcttattcaccggcggagatcgtgaccgagaaacatctcttcttgcggcgg |
22773689 |
T |
 |
| Q |
117 |
tgcggtgataaactggaagtgtgtcgagtgaatcatcgtcagcggttcttctccgttttgtgttctgcggttgctctacagagatgttgatggttccgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || ||| ||||||||||||| | |||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
22773688 |
tgcggtgataaactggaagtgtgtcgagggaatcatcctcggcgtttcttctccgtttcgcgttctgcggttgctctacggcgatgttgatggtaccgtg |
22773589 |
T |
 |
| Q |
217 |
atcg |
220 |
Q |
| |
|
|||| |
|
|
| T |
22773588 |
atcg |
22773585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 454766 - 454725
Alignment:
| Q |
64 |
catcttattcaccgtcggtgatcgtgaccgggaaacgtctct |
105 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
454766 |
catcttattcactgccggtgatcgtgaccgggaaacatctct |
454725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University