View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12489_low_5 (Length: 242)

Name: NF12489_low_5
Description: NF12489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12489_low_5
NF12489_low_5
[»] chr4 (1 HSPs)
chr4 (17-220)||(22773585-22773788)
[»] scaffold0002 (1 HSPs)
scaffold0002 (64-105)||(454725-454766)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 22773788 - 22773585
Alignment:
17 cagagagtgaagagacaaatgaacacaagcaagggaatagcgtgaatcatcttattcaccgtcggtgatcgtgaccgggaaacgtctcttcttgcggcgg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| ||||||||||||||||    
22773788 cagagagtgaagagacaaatgaacacaagcaagggaatagcgtgaatcatcttattcaccggcggagatcgtgaccgagaaacatctcttcttgcggcgg 22773689  T
117 tgcggtgataaactggaagtgtgtcgagtgaatcatcgtcagcggttcttctccgttttgtgttctgcggttgctctacagagatgttgatggttccgtg 216  Q
    |||||||||||||||||||||||||||| |||||||| || ||| ||||||||||||| | |||||||||||||||||| | |||||||||||| |||||    
22773688 tgcggtgataaactggaagtgtgtcgagggaatcatcctcggcgtttcttctccgtttcgcgttctgcggttgctctacggcgatgttgatggtaccgtg 22773589  T
217 atcg 220  Q
    ||||    
22773588 atcg 22773585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 454766 - 454725
Alignment:
64 catcttattcaccgtcggtgatcgtgaccgggaaacgtctct 105  Q
    |||||||||||| | ||||||||||||||||||||| |||||    
454766 catcttattcactgccggtgatcgtgaccgggaaacatctct 454725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University