View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248Ase23 (Length: 108)
Name: NF1248Ase23
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248Ase23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 41675870 - 41675961
Alignment:
| Q |
7 |
agtcctgttgtctagagtctctctctatagttctgttttgctctctgtgaccgttaactgtttactgcatatgtcatacagtacaacttacc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41675870 |
agtcctgttgtctagagtctctctctatagttctgttttgctctctgtgaccgttaactgtttactgcatatgtcatacagtacaacttacc |
41675961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University