View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248Ase25 (Length: 155)
Name: NF1248Ase25
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248Ase25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 10072036 - 10071895
Alignment:
| Q |
8 |
ctttctactaactagtagatactgtgctacaaatgcgggtgcttgaattcaaatagatactgatttaatgattcaaatagatactactaaatcataaact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072036 |
ctttctactaactagtagatactgtgctacaaatgtgggtgcttgaattcaaatagatactgatttaatgattcaaatagatactactaaatcataaact |
10071937 |
T |
|
| Q |
108 |
aggtagactcatatcaatatcaacttatangggatactatta |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10071936 |
aggtagactcatatcaatatcaacttataatggatactatta |
10071895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University