View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248Ase8 (Length: 258)
Name: NF1248Ase8
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248Ase8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 8 - 252
Target Start/End: Complemental strand, 33262576 - 33262342
Alignment:
| Q |
8 |
ggaagatgctggatttaggatgatggacacacagacgaaacatgtttttctatatggatgctacttcaatgaagatatctgctccttattctgagcttac |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33262576 |
ggaaaatgctggatttaggatgatggacacacagaagaaacatgtttttctatatggatgctacttcaatgaagatatctgctccttattcagagcttac |
33262477 |
T |
|
| Q |
108 |
aaattgcaacatatcttccaaaattcagccagtcattacataacattgtttgatattgtgtgttaattacatagttaccatacatatcttccaaaattca |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || | | |
|
|
| T |
33262476 |
aaattccaacatatcttccaaaattcagccagtcattacataacattgtttgatatt--gtgttaattacatagttaccatacata--atcaa------a |
33262387 |
T |
|
| Q |
208 |
gcaagggatcgacatttgtttcaacattaaagggagaaatgatta |
252 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33262386 |
gcaagggatcaacatttgtttcaacattaaagggagaaatgatta |
33262342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University