View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248Eco23 (Length: 186)
Name: NF1248Eco23
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248Eco23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 183
Target Start/End: Complemental strand, 47690086 - 47689912
Alignment:
| Q |
9 |
gctaattggttttttagttcttgattttcaattctcaaccggttcaaccggttcgcgaccgtctctaaatgcttcttctttttgtaacgggaccgttgag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47690086 |
gctaattggttttttagttcttgattttcaattctcaacccgttcaaccggttcgcgaccgtctctaaatgcttcttctttttgtaacgggaccgttgag |
47689987 |
T |
|
| Q |
109 |
ctgattcccggttcgactgcatgcgcctaagctttctttctttcacggagtaatccgcacggtttgaactaattg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47689986 |
ctgattcccggttcgactgcatgcgcctaagctttctttctttcacggagtaatccgcacggtttgaaccaattg |
47689912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University