View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248Eco26 (Length: 317)
Name: NF1248Eco26
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248Eco26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 10 - 315
Target Start/End: Complemental strand, 2290353 - 2290048
Alignment:
| Q |
10 |
aggaagtcaaggaaaaggagaagtcttctgctgaagaactgaaagccgatcccagtgatgctgataagaacgtcaatgctgaggaaattaagcaaagtaa |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290353 |
aggaagtcaaggaaaaggggaagtcttctgctgaagaactgaaagctgatcccagtgatgctgataagaacgtcaatgctgaggaaattaagcaaagtaa |
2290254 |
T |
|
| Q |
110 |
tgtggaaggtgaaactgtgatagctgagaagcctacattgatggctgaaccggcgaaacgaattattgtgcatgctttgtctactgttgctgctgcaaaa |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290253 |
tgtggaagctgaaactgtgatagctgagaagcctacattgatggccgaaccggcgaaacgaattattgtgcatgctttgtctactgttgctgctgcaaaa |
2290154 |
T |
|
| Q |
210 |
ccgcatttggaaaagcctcaagtggaagacacttctatgactgaaccggtgaaacaagtttctgaagaagctttgaatgcagttgtcgctgaaaaaccgt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290153 |
ccgcatttggaaaagcctcaagtggaagacacttctatgactgaaccggtgaaacaagtttctgaagaagctttgaatgcagttgtcgctgaaaaaccgc |
2290054 |
T |
|
| Q |
310 |
aattgg |
315 |
Q |
| |
|
|||||| |
|
|
| T |
2290053 |
aattgg |
2290048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 307
Target Start/End: Complemental strand, 2289814 - 2289723
Alignment:
| Q |
216 |
ttggaaaagcctcaagtggaagacacttctatgactgaaccggtgaaacaagtttctgaagaagctttgaatgcagttgtcgctgaaaaacc |
307 |
Q |
| |
|
||||||||||||||||||||||| | ||| || | ||||||||| ||||| |||||| ||||||||| | || ||||| ||||||||||| |
|
|
| T |
2289814 |
ttggaaaagcctcaagtggaagaaccatctctggcggaaccggtggaacaactttctgtggaagctttggacgctgttgttgctgaaaaacc |
2289723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 2290066 - 2290026
Alignment:
| Q |
201 |
gctgcaaaaccgcatttggaaaagcctcaagtggaagacac |
241 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
2290066 |
gctgaaaaaccgcaattggaaaatcctcaagtggaagacac |
2290026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University