View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248_high_5 (Length: 423)
Name: NF1248_high_5
Description: NF1248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 50 - 412
Target Start/End: Original strand, 51104528 - 51104894
Alignment:
| Q |
50 |
tttggctgggaaagacaagttgtttttatgcccac---------attcattgtgctcatttggagttaattttatttttggatagtcaaatgtttgtttg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51104528 |
tttggctgggaaagacaagttgtttttatgcccactttgtttacattcattgtgttcatttggagttaattttatttttggatagtcaaatgttt----- |
51104622 |
T |
 |
| Q |
141 |
ttttgtttctagtttaaatccacctcctagtcaacactctttcagtgttcaacccaactttctgcttgggacctcatttggagcttagttactgaacatt |
240 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
51104623 |
ttttgtttctagtttgaatccacctcctagtcaatactctttcagtgttcaaccgaactgtctgcttgggacctcatttggagctgagttacttaacatt |
51104722 |
T |
 |
| Q |
241 |
atttattaggatttatttctatgaatggcatctattagaagaaccttgtctcctgttcctctacccgcaactgcagcaaatgtagatgtctgttcagtat |
340 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51104723 |
atttatcagtatttatttctatgaatggcatctattagaagaaccttgtctcctgttcctcgacccgcaactgcagcaaatgtagatgtctgttcagtat |
51104822 |
T |
 |
| Q |
341 |
cttccccgttgtctaagtcctcacctagcccccagaagtttgttccatcctatggatttttaccttcttcat |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51104823 |
cttccccgttgtctaagtcctcacctagcccccagaagttttttccatcctatggatttttaccttcttcat |
51104894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University