View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248_low_16 (Length: 311)
Name: NF1248_low_16
Description: NF1248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 103 - 305
Target Start/End: Original strand, 26540594 - 26540798
Alignment:
| Q |
103 |
agtatcatcatcatctcggcgtgactaaggtgcttgatgaaggacaatgactttatgacacctactatctag--gtcgatagagtagcccttggggttgt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
26540594 |
agtatcatcatcatctcgacgtgactaaggtgcttgatgaaggaccatgactttatgacacctaccatctagtggtcgatagagtagcccctggggttgt |
26540693 |
T |
|
| Q |
201 |
tcccaacaggtaagcctggaccatcttgatatatggattcaggttcacaaccttccttttggtctcattcaaccacaagttgcacatggcttagatctct |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
26540694 |
tcccaacaggtgagcctggaccatcttgatatatggattcaggttcacaaccttccttttggtctcattcaaccacaagttgcacatgggttaggtctct |
26540793 |
T |
|
| Q |
301 |
tcctt |
305 |
Q |
| |
|
||||| |
|
|
| T |
26540794 |
tcctt |
26540798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University