View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1248_low_22 (Length: 219)
Name: NF1248_low_22
Description: NF1248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1248_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 11 - 89
Target Start/End: Original strand, 42824615 - 42824693
Alignment:
| Q |
11 |
cacagatccaccacaaacctcttctccgacccactcgactcccatcctctctggttcaaacctacctccttcctctccc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42824615 |
cacagatccaccacaaacctcttctccgacccactcgactcccatcctctctggttcaaacctacctccttcctctccc |
42824693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 147 - 199
Target Start/End: Complemental strand, 14655969 - 14655918
Alignment:
| Q |
147 |
gatccaattgagtattcccttaatcattttagtgaaccacttgaaacacatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14655969 |
gatccaattgagtattcccttaatca-tttagtgaaccacttgaaacacatct |
14655918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University