View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249-Insertion-1 (Length: 209)
Name: NF1249-Insertion-1
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249-Insertion-1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 7 - 187
Target Start/End: Complemental strand, 43224228 - 43224045
Alignment:
| Q |
7 |
aaaactccctacattaacacagaaaatttggtgagaattgtactattttcgaaggatagtaactctctatactagcagagtctaagtcttaggtaagttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224228 |
aaaactccctacattaacacagaaaatttggtgagaattgtactattttcgaaggatagtaactctctatactagcagagtctaagtcttaggtaagttt |
43224129 |
T |
 |
| Q |
107 |
tctaatctctatattgttgcttgcacctttcattatgcttcttcttcnnnnnnn---cttgctttgatgtgccttccatttccc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43224128 |
tctaatctctatattgttgcttgcacctttcattatgcttcttcttcttctttttttcttgctttgatgtgccttccatttccc |
43224045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University