View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249-Insertion-2 (Length: 140)
Name: NF1249-Insertion-2
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249-Insertion-2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 6e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 2912594 - 2912724
Alignment:
| Q |
7 |
aaatctatctatctatatctatgtataaacctttacaattattgcatcaatgattataagtgtctggaccgagttagttttatgattatgaatttataac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2912594 |
aaatctatctatctatatctatgtataaacctttacaattattgcatcaatgattataagtgtctggaccgagttagttttatgattatgaatttataat |
2912693 |
T |
|
| Q |
107 |
gtttctttagctaatttgtaacaaaggtagt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2912694 |
gtttctttagctaatttgtaacaaaggtagt |
2912724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 82 - 140
Target Start/End: Original strand, 2915055 - 2915113
Alignment:
| Q |
82 |
agttttatgattatgaatttataacgtttctttagctaatttgtaacaaaggtagtgaa |
140 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || ||||||||| |||||||| |||| |
|
|
| T |
2915055 |
agttttatgattatgaatttttaatgtttcttcaggtaatttgtaccaaaggtaatgaa |
2915113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University