View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249-Insertion-2 (Length: 140)

Name: NF1249-Insertion-2
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249-Insertion-2
NF1249-Insertion-2
[»] chr2 (2 HSPs)
chr2 (7-137)||(2912594-2912724)
chr2 (82-140)||(2915055-2915113)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 6e-66; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 7 - 137
Target Start/End: Original strand, 2912594 - 2912724
Alignment:
7 aaatctatctatctatatctatgtataaacctttacaattattgcatcaatgattataagtgtctggaccgagttagttttatgattatgaatttataac 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
2912594 aaatctatctatctatatctatgtataaacctttacaattattgcatcaatgattataagtgtctggaccgagttagttttatgattatgaatttataat 2912693  T
107 gtttctttagctaatttgtaacaaaggtagt 137  Q
    |||||||||||||||||||||||||||||||    
2912694 gtttctttagctaatttgtaacaaaggtagt 2912724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 82 - 140
Target Start/End: Original strand, 2915055 - 2915113
Alignment:
82 agttttatgattatgaatttataacgtttctttagctaatttgtaacaaaggtagtgaa 140  Q
    |||||||||||||||||||| ||| ||||||| || ||||||||| |||||||| ||||    
2915055 agttttatgattatgaatttttaatgtttcttcaggtaatttgtaccaaaggtaatgaa 2915113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University