View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249-Insertion-5 (Length: 113)
Name: NF1249-Insertion-5
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249-Insertion-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 44952117 - 44952016
Alignment:
| Q |
8 |
gccacactcttaacaattatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttcccagttttgtagtatcttaattgattgaccaatca |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44952117 |
gccacactcttaacaaatatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttcccagttttgtagtatc----ttgattgaccaatca |
44952022 |
T |
 |
| Q |
108 |
ccatga |
113 |
Q |
| |
|
|||||| |
|
|
| T |
44952021 |
ccatga |
44952016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University