View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249-Insertion-8 (Length: 58)
Name: NF1249-Insertion-8
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 33516956 - 33517006
Alignment:
| Q |
8 |
cttttgatccgttaagagatttgaattgtacctctcaatagtaaaacagta |
58 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33516956 |
cttttgatccgttaagagatttgaattggacctctcaatagtaaaacagta |
33517006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University