View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_high_18 (Length: 362)
Name: NF12492_high_18
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_high_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 25 - 362
Target Start/End: Complemental strand, 41142020 - 41141682
Alignment:
| Q |
25 |
agattagttattagtataagtagctggaccagaagataatttggttttgacaattttgcagcctcatttgttaccacatgtgggagatattcctcgcagc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41142020 |
agattagttattagtataagtagctggaccagaagataatttggttttgacaattttgcagcctcatttgttaccacatgtgggagatattccacgcagc |
41141921 |
T |
 |
| Q |
125 |
aactttcaatttgattttggattggagaggaaaattttggctgaagcagagaaggagaacccaaattggaccaaatttggggtagcaaatcttccaacca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41141920 |
aactttcaatttgattttggattggagaggaaaattttggctgaagcagagaaggagaacccaaattggaccaaatttggggtagaaaatcttccaacca |
41141821 |
T |
 |
| Q |
225 |
aggcttctgattcatcaccgtcatcaaaggtgatctttcataatttagagcaagaagttccgatttatgctagtttgcgtttatg-nnnnnnnnnncttt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41141820 |
aggcttctgattcatcaccgtcatcaaaggtgatttttcataatttagagcaagaagttccgatttattctagtttgcgtttatgtttttttttttcttt |
41141721 |
T |
 |
| Q |
324 |
ctgattcattatgctgatgttgtgacttactatttgctt |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41141720 |
ctgattcattatgcagatgttgtgacttactatttgctt |
41141682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University