View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_high_20 (Length: 338)
Name: NF12492_high_20
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 14 - 320
Target Start/End: Original strand, 28046338 - 28046644
Alignment:
| Q |
14 |
agaggaagatgaagaaccaattgaagaggaggtatatggcagatctctgctagggaagctttggactgataatgcttacaacgttagagcttttaagcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28046338 |
agaggaagatgaagaaccaattgaagaggaggtatatggcagatctctgctagggaagctttggactgataatgcttacaatgttagagcttttaagcaa |
28046437 |
T |
 |
| Q |
114 |
acgattgtggaattctggaggctcaaaaatccagttgaaacacaagaacttggtaagaatctttaccttttccggttttgtaataaacgtgatatggaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28046438 |
acgattgtggaattctggaggctcaaaaatccagttgaaacacaagaacttggtaagaatctttaccttttccggttttgtaataaacgtgatctggaaa |
28046537 |
T |
 |
| Q |
214 |
atgtgataaaaaatggaccttggagctttgatagaaatattctggtactgaagagggttacaggtactgaacaaccttctgaaatagaaatgaattcaat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28046538 |
atgtgataaaaaatggaccttggagctttgatagaaatattctggtattgaagagggttacaggtactgaacaaccttctgaaatagaaatgaattcaat |
28046637 |
T |
 |
| Q |
314 |
gtcattt |
320 |
Q |
| |
|
||||||| |
|
|
| T |
28046638 |
gtcattt |
28046644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University