View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_low_18 (Length: 380)
Name: NF12492_low_18
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 123 - 367
Target Start/End: Original strand, 36900001 - 36900245
Alignment:
| Q |
123 |
gtcaccaatcgaggaagtccggttaacggtgnnnnnnnccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctcatgc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36900001 |
gtcaccaatcgaggaagtccggttaacggtgaaaaaaaccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctcatgc |
36900100 |
T |
|
| Q |
223 |
gctctcctctcctttctcaaccaattcttcgcataccgaaccgaaccactcatcataactcaaatcaccgttcaagtcgccacactccccctcggccacc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36900101 |
gctctcctctcctttctcaaccaattcttcgcataccgaaccgaaccactcatcataactcaaatcaccgttcaagtcgccacactccccctcggccacc |
36900200 |
T |
|
| Q |
323 |
tcatggcctccgtgttaccttcaaagacgttcaggatcacaggtt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36900201 |
tcatggcctccgtgttaccttcaaagacgttcaggatcccaggtt |
36900245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 36899894 - 36899976
Alignment:
| Q |
19 |
catagtgcatcacaaagtagagaaaggagagttgagaaattatcaatggagaacatcaacttagacaccgaaaaaggaaccat |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36899894 |
catagtgcatcacaaagtagggaaaggagagttgagaaaatatcaatggagaacatcaacgtagacaccgaaaaaggaaccat |
36899976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 161 - 311
Target Start/End: Complemental strand, 2176335 - 2176185
Alignment:
| Q |
161 |
ccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctcatgcgctctcctctcctttctcaaccaattcttcgcataccg |
260 |
Q |
| |
|
||||||||||||| | ||||||||||| ||||| |||||||| ||||||| | |||||| | ||||| || || ||||||||||||||||| ||||| |
|
|
| T |
2176335 |
ccgacgacccaacccaaccagtatggacattccgtatgtggttcttaggtctcatttcatgctcactcctttctttcctcaaccaattcttcgcttaccg |
2176236 |
T |
|
| Q |
261 |
aaccgaaccactcatcataactcaaatcaccgttcaagtcgccacactccc |
311 |
Q |
| |
|
|| |||||||||||||| |||| || |||||||| || || |||||||| |
|
|
| T |
2176235 |
tacagaaccactcatcatcactctcataaccgttcaggtagctacactccc |
2176185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University