View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_low_28 (Length: 288)
Name: NF12492_low_28
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 43850506 - 43850744
Alignment:
| Q |
19 |
gttaatggttattatgatgatgaaatcctaagttactaattggcccttaggcttagtacttgtcttgagggtattcacggtaattttcaggatactagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
43850506 |
gttaatggttattatgatgatgaaatcctaagttactaattggcccataggcttagtacttgtcttgagggtattcgcggtaattttcaggatactggaa |
43850605 |
T |
|
| Q |
119 |
cttctctacttgtttgcgatgtagtatgatgatacttggattaccttagctttctatggaaactaaaacatgtacgtgtcatgtacagcaacatacgata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43850606 |
cttctctacttgtttgcgatgtagtatgatgatacttggattaccttagctttctatggaaactaaaacatgtacgtgtcatgtacagcaacatacgata |
43850705 |
T |
|
| Q |
219 |
agatactttttgcccgagccaggatcctctccattgaga |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43850706 |
agatactttttgcccgagccaggatcctctccattgaga |
43850744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University