View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12492_low_28 (Length: 288)

Name: NF12492_low_28
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12492_low_28
NF12492_low_28
[»] chr4 (1 HSPs)
chr4 (19-257)||(43850506-43850744)


Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 257
Target Start/End: Original strand, 43850506 - 43850744
Alignment:
19 gttaatggttattatgatgatgaaatcctaagttactaattggcccttaggcttagtacttgtcttgagggtattcacggtaattttcaggatactagaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||    
43850506 gttaatggttattatgatgatgaaatcctaagttactaattggcccataggcttagtacttgtcttgagggtattcgcggtaattttcaggatactggaa 43850605  T
119 cttctctacttgtttgcgatgtagtatgatgatacttggattaccttagctttctatggaaactaaaacatgtacgtgtcatgtacagcaacatacgata 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43850606 cttctctacttgtttgcgatgtagtatgatgatacttggattaccttagctttctatggaaactaaaacatgtacgtgtcatgtacagcaacatacgata 43850705  T
219 agatactttttgcccgagccaggatcctctccattgaga 257  Q
    |||||||||||||||||||||||||||||||||||||||    
43850706 agatactttttgcccgagccaggatcctctccattgaga 43850744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University