View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_low_37 (Length: 223)
Name: NF12492_low_37
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 46314604 - 46314414
Alignment:
| Q |
18 |
gttagggtatcttgatccatgctatcttgcaccggaggatcttagcgcgaagagtgatgtgttcagttttgggatcttgttattggagattatcagtgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314604 |
gttagggtatcttgatccatgctatcttgcaccggaggatcttagcgcgaagagtgatgtgttcagttttgggatcttgttattggagattatcagtgga |
46314505 |
T |
 |
| Q |
118 |
agaaatgcgattgatgttaattatagtcctccttcagtggtggattgggcggtgccgttgattagaaaaggtgatttcgtcgggatctgtg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46314504 |
agaaatgcgattgatgttaattatagtcctccttcagtggtggattgggcggtgccgttgattagaaaaggtgatttcgtcgggatctgtg |
46314414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 67 - 167
Target Start/End: Original strand, 15171879 - 15171979
Alignment:
| Q |
67 |
aagagtgatgtgttcagttttgggatcttgttattggagattatcagtggaagaaatgcgattgatgttaattatagtcctccttcagtggtggattggg |
166 |
Q |
| |
|
|||| |||||| || ||||||||||| ||||| ||||||||||| ||||||||||| || ||||||||| |||| |||||||| || |||||||||| |
|
|
| T |
15171879 |
aagattgatgtttttagttttgggattttgttgttggagattattagtggaagaaaagctattgatgttgcttattcacctccttctgttgtggattggg |
15171978 |
T |
 |
| Q |
167 |
c |
167 |
Q |
| |
|
| |
|
|
| T |
15171979 |
c |
15171979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University