View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12492_low_41 (Length: 211)
Name: NF12492_low_41
Description: NF12492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12492_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 31809258 - 31809063
Alignment:
| Q |
1 |
aaatggtataataaatacaatattatttaaaactgacttaaatgtatttattttcaacttattttgttgtaggccataaagactgttgacaaacacttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31809258 |
aaatggtataataaatacaatattatttaaaactgacttaaatgtatttattttcaacttattttgttgtaggccataaagactgtttacaaacacttgg |
31809159 |
T |
 |
| Q |
101 |
agaagatggtacaattatccattgcaacaacaatagcttgcaatacacttgccacccttaggaaacttactttttgcacaataattggcacaatct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809158 |
agaagatggtacaattatccattgcaacaacaatagcttgcaatacacttgccacccttaggaaacttactttttgcacaataattggcacaatct |
31809063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University