View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12493_high_10 (Length: 309)
Name: NF12493_high_10
Description: NF12493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12493_high_10 |
 |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 211 - 294
Target Start/End: Complemental strand, 45192235 - 45192152
Alignment:
| Q |
211 |
cccatgccattttttactaaaattatttaattaaaatctactttagcatcaaaccggtccgattcaccaaaaccgccggttcac |
294 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45192235 |
cccatgccaatttttactaaaattatataattaaattctacttcagcatcaaaccggtccggttcaccaaaaccgccggttcac |
45192152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 45 - 143
Target Start/End: Complemental strand, 45192132 - 45192032
Alignment:
| Q |
45 |
ccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcaccttaccgattcccggtcgaacc--ggccgatccggtccggtttttaaaactat |
142 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||| ||| ||||| |||||| || ||||||||||||| |
|
|
| T |
45192132 |
ccggttcgaatgcatggccgatccgtttggtgactcgaaccggtcaccctaccgattcctggtcggaccggggccggtccggttcgatttttaaaactat |
45192033 |
T |
 |
| Q |
143 |
g |
143 |
Q |
| |
|
| |
|
|
| T |
45192032 |
g |
45192032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Original strand, 28235735 - 28235767
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
28235735 |
accggccggtccggtccggtttttaaaactatg |
28235767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 28283015 - 28283055
Alignment:
| Q |
103 |
ccggtcgaaccggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
28283015 |
ccggtcggaccggccgatccggttcgggttttaaaactatg |
28283055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 92
Target Start/End: Complemental strand, 48302624 - 48302548
Alignment:
| Q |
16 |
cgagtttcaccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcacc |
92 |
Q |
| |
|
||||||| ||||||| ||| |||||| ||||||| || |||||| ||||||||||| |||||||||||||||| |
|
|
| T |
48302624 |
cgagtttggccgagtctcactggttcaggccggtttgattgcatgaccgatccgtttatcaactcgaaccggtcacc |
48302548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 148 - 210
Target Start/End: Original strand, 31347148 - 31347210
Alignment:
| Q |
148 |
gaacaaaataatgcaaaatttattataatacacttcatgatttacatagacgttgatgaatgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31347148 |
gaacaaaataatgcaaaatttattataatacacttcatgatttacatagacgttgatgaatgc |
31347210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 78 - 144
Target Start/End: Original strand, 16089055 - 16089121
Alignment:
| Q |
78 |
ctcgaaccggtcaccttaccgattcccggtcgaaccggccgatccggtccggtttttaaaactatgg |
144 |
Q |
| |
|
|||||||||| |||| |||| |||||||| | ||| |||| |||| |||||||||||||||||||| |
|
|
| T |
16089055 |
ctcgaaccggatacctcaccggttcccggttggaccagccggtccgatccggtttttaaaactatgg |
16089121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 13486596 - 13486535
Alignment:
| Q |
11 |
ttcagcgagtttcaccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgttt |
72 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||| ||||||| || |||||| ||||||||||| |
|
|
| T |
13486596 |
ttcaccgagtttggccgagtctcaccggttcaggccggtttgattgcatgaccgatccgttt |
13486535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 78 - 146
Target Start/End: Complemental strand, 8014216 - 8014148
Alignment:
| Q |
78 |
ctcgaaccggtcaccttaccgattcccggtcgaaccggccgatccggtccggtttttaaaactatggca |
146 |
Q |
| |
|
||||||||||||| | ||| |||||||| |||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
8014216 |
ctcgaaccggtcaggtgtccggttcccggttgaaccggccggtccgagccgggttttaaaactatggca |
8014148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Complemental strand, 40484721 - 40484689
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
40484721 |
accggccggtccggtccggtttttaaaactatg |
40484689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 42064199 - 42064239
Alignment:
| Q |
103 |
ccggtcgaaccggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
42064199 |
ccggtcgaaccggccggtccggtccgagttttaaaactatg |
42064239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 11411776 - 11411709
Alignment:
| Q |
211 |
cccatgccattttttactaaaattatttaattaaaatctactttagcatcaaaccggtccgattcacc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
11411776 |
cccatgccattttttactaaaattatttaattaaattctacttcagcatcaaaccggtccggttcacc |
11411709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 40 - 102
Target Start/End: Complemental strand, 11411690 - 11411628
Alignment:
| Q |
40 |
tcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcaccttaccgattc |
102 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11411690 |
tcatgccggtttgaatgcatggccgatccgtttggtgactcgaaccggtcaccctaccgattc |
11411628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 211 - 293
Target Start/End: Complemental strand, 39749702 - 39749620
Alignment:
| Q |
211 |
cccatgccattttttactaaaattatttaattaaaatctactttagcatcaaaccggtccgattcaccaaaaccgccggttca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| | ||| |||| |||||| | ||||||| |
|
|
| T |
39749702 |
cccatgccattttttactaaaattatttaattaaattctacttcagcatcaaaccaggccggttcatcaaaactgtcggttca |
39749620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 54
Target Start/End: Complemental strand, 39749617 - 39749570
Alignment:
| Q |
7 |
ggttttcagcgagtttcaccgagtcacaccggttcatgccggttcgaa |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
39749617 |
ggttttcagcgagtttgaccgagtcacaccggtttatgccggttcgaa |
39749570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 25 - 144
Target Start/End: Original strand, 39851362 - 39851485
Alignment:
| Q |
25 |
ccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcaccttaccgattcccggtcgaaccgg-----ccga |
119 |
Q |
| |
|
||||||| || ||||||| ||||||| || |||||| ||||||||||| ||||||||||||||||| |||| ||| |||||| ||||| ||| |
|
|
| T |
39851362 |
ccgagtctcatcggttcaggccggtttgattgcatgaccgatccgtttatcaactcgaaccggtcacctcaccggttcacggtcggaccggttcaaccg- |
39851460 |
T |
 |
| Q |
120 |
tccggtccggtttttaaaactatgg |
144 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39851461 |
gccggtccggtttttaaaactatgg |
39851485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 11675683 - 11675586
Alignment:
| Q |
17 |
gagtttcaccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcaccttaccgattcccggtcgaaccg |
114 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||| || || | |||| ||||||||||| |||||||||||||||| |||| |||| ||||| |||| |
|
|
| T |
11675683 |
gagtttgaccgagtcacgccggttcattccgatttgattacatgaccgatccgtttatcaactcgaaccggtcaccccaccggttcctggtcggaccg |
11675586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Complemental strand, 2848526 - 2848494
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
2848526 |
accggccggtccggtccggtttttaaaactatg |
2848494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 11334912 - 11334856
Alignment:
| Q |
16 |
cgagtttcaccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgttt |
72 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||| || |||||| ||||||||||| |
|
|
| T |
11334912 |
cgagtttggccgagtctcaccggttcaggccggtttgattgcatgaccgatccgttt |
11334856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Original strand, 33635844 - 33635876
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
33635844 |
accggccgatccggtccggttttcaaaactatg |
33635876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 92
Target Start/End: Complemental strand, 39168571 - 39168503
Alignment:
| Q |
24 |
accgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcacc |
92 |
Q |
| |
|
|||||||||||| || ||| |||||||||| ||||| |||||||||| | |||||| |||||| |||| |
|
|
| T |
39168571 |
accgagtcacactggctcacaccggttcgaaagcatggccgatccgttagttgactcaaaccggccacc |
39168503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 78 - 144
Target Start/End: Complemental strand, 17643562 - 17643496
Alignment:
| Q |
78 |
ctcgaaccggtcaccttaccgattcccggtcgaaccggccgatccggtccggtttttaaaactatgg |
144 |
Q |
| |
|
|||||||||| ||||| ||| ||| |||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
17643562 |
ctcgaaccggacacctcaccagttcacggtcggaccggccggtccggtccggtttttaaaactatgg |
17643496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 92
Target Start/End: Complemental strand, 6513892 - 6513826
Alignment:
| Q |
26 |
cgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcacc |
92 |
Q |
| |
|
|||||| |||||||||| ||||||| || |||||| ||||||||||| |||||||||||||||| |
|
|
| T |
6513892 |
cgagtctcaccggttcaggccggtttgattgcatgaccgatccgtttatcaactcgaaccggtcacc |
6513826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Complemental strand, 8760240 - 8760208
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
8760240 |
accggccgatccggtccggttttcaaaactatg |
8760208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 78 - 143
Target Start/End: Complemental strand, 21800026 - 21799961
Alignment:
| Q |
78 |
ctcgaaccggtcaccttaccgattcccggtcgaaccggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
|||||||||| ||||| |||| || |||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
21800026 |
ctcgaaccggacacctcaccggttaacggtcggaccgaccggtccggtccggtttttaaaactatg |
21799961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 115
Target Start/End: Original strand, 24129428 - 24129526
Alignment:
| Q |
17 |
gagtttcaccgagtcacaccggttcatgccggttcgaatgcatgtccgatccgtttggtgactcgaaccggtcaccttaccgattcccggtcgaaccgg |
115 |
Q |
| |
|
|||||| |||||||||| |||||||| |||||| || | |||| ||||||||||| |||||||||||||| | |||| |||| ||||||||||| |
|
|
| T |
24129428 |
gagtttgaccgagtcacgccggttcagtccggtttgattacatgaccgatccgtttatcaactcgaaccggtcatcccaccggttcctggtcgaaccgg |
24129526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 144
Target Start/End: Original strand, 3989774 - 3989807
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatgg |
144 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
3989774 |
accggccggtccggtccggtttttaaaactatgg |
3989807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 143
Target Start/End: Original strand, 31901831 - 31901863
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
31901831 |
accggccgatccggtccggttttcaaaactatg |
31901863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 145
Target Start/End: Complemental strand, 36098856 - 36098822
Alignment:
| Q |
111 |
accggccgatccggtccggtttttaaaactatggc |
145 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
36098856 |
accggccggtccggtccggtttttaaaactatggc |
36098822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 103 - 145
Target Start/End: Original strand, 44352843 - 44352885
Alignment:
| Q |
103 |
ccggtcgaaccggccgatccggtccggtttttaaaactatggc |
145 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
44352843 |
ccggtcgaaccggccggtccggtccgagttttaaaactatggc |
44352885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 143
Target Start/End: Original strand, 65108 - 65148
Alignment:
| Q |
103 |
ccggtcgaaccggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
65108 |
ccggtcgaaccggccgatctggtccgagttttaaaactatg |
65148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 6140927 - 6140887
Alignment:
| Q |
103 |
ccggtcgaaccggccgatccggtccggtttttaaaactatg |
143 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6140927 |
ccggtcgaaccggccgatccggtccaagttttaaaactatg |
6140887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University