View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12493_high_16 (Length: 218)
Name: NF12493_high_16
Description: NF12493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12493_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 26935793 - 26935979
Alignment:
| Q |
13 |
gaagcagagattgcaaatactgaacacaggaaatcttgtgcttgtggatgaattcaacaatatcaaatggcaaagtttcaattttccaactgatgtaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935793 |
gaagcagagattgcaaatactgaacacaggaaatcttgtgcttgtggatgaattcaacaatatcaaatggcaaagtttcaattttccaactgatgtaatg |
26935892 |
T |
|
| Q |
113 |
ctatggggccagcaacttgatgtagcgactcgattaacatcgtcgcgaaccaactcaagcatgttctactcattcgaaatcgagaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26935893 |
ctatggggccagcaacttgatgtagcgactcgattaacatcgtcgcgaaccaactcaagcatgttctactcattcgaaatcgagaat |
26935979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University