View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12493_low_14 (Length: 243)

Name: NF12493_low_14
Description: NF12493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12493_low_14
NF12493_low_14
[»] chr3 (2 HSPs)
chr3 (76-176)||(275836-275936)
chr3 (1-49)||(275395-275443)
[»] chr4 (1 HSPs)
chr4 (95-129)||(46662938-46662972)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 76 - 176
Target Start/End: Original strand, 275836 - 275936
Alignment:
76 tatcatatgacgtgtattggatttatagataactttaattaattaaataaaatacaaaatggaatcaactattaaaatattattgcacttgaaaccatat 175  Q
    |||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| || ||||    
275836 tatcatatgatgtgtattagatttacagataactttaattaattaaataaaatacaaaatggaatcaattattaaaatagtattgcacttgagactatat 275935  T
176 a 176  Q
    |    
275936 a 275936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 275395 - 275443
Alignment:
1 agcagagaaaaatgtttagaactctattgatgtgcagactattatcata 49  Q
    ||||||||||||||| ||||||||||||||||||  |||||||||||||    
275395 agcagagaaaaatgtctagaactctattgatgtgtggactattatcata 275443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 129
Target Start/End: Complemental strand, 46662972 - 46662938
Alignment:
95 gatttatagataactttaattaattaaataaaata 129  Q
    ||||||| |||||||||||||||||||||||||||    
46662972 gatttatggataactttaattaattaaataaaata 46662938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University