View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12494_low_2 (Length: 468)
Name: NF12494_low_2
Description: NF12494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12494_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 4e-73; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 257 - 436
Target Start/End: Complemental strand, 44342035 - 44341847
Alignment:
| Q |
257 |
atgtttttgcagatgcataccttatagatataaagaagacatagatggtaatatgagcaacgaattggaagtactagtggttagttcgcagaaaagtcag |
356 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342035 |
atgtttgtgcagatgcataccttatagatataaagaagacatagatggtaataggagcaacgaattggaagtactagtggttagttcgcagaaaagtcag |
44341936 |
T |
 |
| Q |
357 |
agactaatgtttcctaaggtatccacattttttaaatt----aattttagtgttactcgcac-----attagtttgcttttggaacccc |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44341935 |
agactaatgtttcctaaggtatccacattttttaaattaattaatttcagtgttactcgcacattatattagtttgcttttggaacccc |
44341847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 12 - 133
Target Start/End: Complemental strand, 44342271 - 44342149
Alignment:
| Q |
12 |
gcagagatataacaacatgggtggccgccaagttgtagggtgagtagtact-acttattcaatttctcactattcacttcatttttcacgtttcaaaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342271 |
gcagagatataacaacatgggtggccgccaagttgttgggtgagtagtacttactttttcaatttctcactattcacttcatttttcacgtttcaaaaat |
44342172 |
T |
 |
| Q |
111 |
atttggtaggtgacatgcctcat |
133 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44342171 |
atttggtaggtgacatgcctcat |
44342149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 152 - 186
Target Start/End: Complemental strand, 44342141 - 44342107
Alignment:
| Q |
152 |
attaatatttaatcatgtctttagctcgattcact |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342141 |
attaatatttaatcatgtctttagctcgattcact |
44342107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 11455629 - 11455690
Alignment:
| Q |
282 |
agatataaagaagacatagatggtaatatgagcaacgaattggaagtactagtggttagttc |
343 |
Q |
| |
|
||||||||| ||||||| ||||| |||||| | || |||||||||||||| || |||||||| |
|
|
| T |
11455629 |
agatataaacaagacattgatggcaatatgggtaatgaattggaagtacttgttgttagttc |
11455690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University