View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12494_low_3 (Length: 437)
Name: NF12494_low_3
Description: NF12494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12494_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 272
Target Start/End: Complemental strand, 6906725 - 6906464
Alignment:
| Q |
11 |
cagagacaggtattcaactgtgctttccagaatacatttttaatcacttagattttgtattcatctttcttacctcttcacgagcataaggacactctta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6906725 |
cagagacaggtattcaactgtgctttcctgaatacatttttaatcgcttagattttgtattcatctttcttacctcttcacgagcataaggacactctta |
6906626 |
T |
 |
| Q |
111 |
attatattactcttgcaaactttcacacaaaaatgttgcaatgatacgaattgtcggttcgaagctcaagcattccactctgaccaaaggaccaaattac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6906625 |
attatattactcttgcaaactttcacacaaaaatgttgcaatgatacgaattgtcggctcgaagcttaagcattccactctgatcaaaggaccaaattac |
6906526 |
T |
 |
| Q |
211 |
ctaatcactactgatatatttatttaaaacccaacaaaattatttatagttgaggtgtttca |
272 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
6906525 |
ctaatcactactgatatatttattcaaaaccctacaaaattatttactgttgaggtgtttca |
6906464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University