View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12494_low_6 (Length: 348)
Name: NF12494_low_6
Description: NF12494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12494_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 51324366 - 51324499
Alignment:
| Q |
18 |
ttttcatggttaaattttgttt-caatatacctaggtgttcataataatgaaataaataaatgaacggtgacatttatatacagatactccatacgtagt |
116 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51324366 |
tttttatggttaaattttgttttcaatatacctaggtgttcataataatgaaataaataaatgaacggtgacatttatatacagatactccatacgtagt |
51324465 |
T |
 |
| Q |
117 |
tcaaaatagtgaacattaatggttctttctcgtc |
150 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
51324466 |
tcaaaatagtgaacactaatggttctttctcgtc |
51324499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University