View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12495_high_4 (Length: 286)
Name: NF12495_high_4
Description: NF12495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12495_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 142 - 280
Target Start/End: Original strand, 9696846 - 9696984
Alignment:
| Q |
142 |
atctatatgaagggtagtttctttgctacaatatagtaccaattgctctgtacaagtgatacacaaattagcaactacacatagcagagccacaacaaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9696846 |
atctatatgaagggtagtttctttgctacaatatagtaccaattgctctgtacaagtgatacacaaattagcaactacacatagcagagccacaacaaat |
9696945 |
T |
 |
| Q |
242 |
tcacatgtggtttgaggctaatatttaagtctctgctcc |
280 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
9696946 |
tcacatgtggtttgaggctaatgtttaagtttctgctcc |
9696984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 9696367 - 9696489
Alignment:
| Q |
17 |
agaagataaattggagttgattcactggaatgtaaatgggagtctatatatagcaccagctacaagtttataaaaatatctaggtaggtaactcgtgcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9696367 |
agaagataaattggagttgattcactggaatgtaaatgagagtctatatatagcaccagctacaagtttataaaaatatctaggtaggtaactcgtgcaa |
9696466 |
T |
 |
| Q |
117 |
ctaataaactaaacgggattagt |
139 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9696467 |
ctaataaactaaacgggattagt |
9696489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University