View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12495_high_6 (Length: 257)
Name: NF12495_high_6
Description: NF12495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12495_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 24125392 - 24125247
Alignment:
| Q |
1 |
gagctaatagagtagggcgatggggggtgagtctaggtcagactatctctggaaacaaggacctagtttttgtcaaccccacctgagagtgttcactttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
24125392 |
gagctaatagagtagggcgatggggggtgagtctaggtcagactatccctggaaacaaggacctagtttttgtcaaccccacccgggagtgttcactttt |
24125293 |
T |
|
| Q |
101 |
cttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
146 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24125292 |
cttattttgaaagtttccaaatgttcttttcagttagattgcttat |
24125247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 171 - 217
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
| Q |
171 |
tttggcgactcttgtatcatatctcttctttgttttatatatataat |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24124546 |
tttggcgactcttgtatcgtatctcttctttgttttatatatataat |
24124500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 36 - 146
Target Start/End: Original strand, 45163326 - 45163435
Alignment:
| Q |
36 |
ggtcagactatctctggaaacaaggacctagtttttgtcaaccccacctgagagtgttcacttttcttattttgaaagttttcaaatgttcttttcagtt |
135 |
Q |
| |
|
||||| |||||| ||| || ||||||||| ||| ||| ||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| || |
|
|
| T |
45163326 |
ggtcaaactatccctgaaagcaaggacctggttcttgccaaccccacctaggagtgttcactttacttattttgaaagttttcaaat-ttcttttcaatt |
45163424 |
T |
|
| Q |
136 |
aggttgcttat |
146 |
Q |
| |
|
| | ||||||| |
|
|
| T |
45163425 |
acgctgcttat |
45163435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University