View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12498_high_7 (Length: 271)
Name: NF12498_high_7
Description: NF12498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12498_high_7 |
 | |
|
| [»] scaffold1034 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1034 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 59 - 261
Target Start/End: Original strand, 344 - 546
Alignment:
| Q |
59 |
actgaatactatcacaattcagacctcgggtaaccaatcttcatagaaaagagcaaagagtgctggaaaaatcttctttttggcaaggtctccagatgct |
158 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
344 |
actgaatacaatcacaattcagacctcgggtaaccaatcttcatagaaaagagcaaaaagtgctggaaaaatcttctttttggcaaggtctccagatgct |
443 |
T |
|
| Q |
159 |
ccaacaacggttatactcaggttggatcctgtagattcagagtctgacaacgaaaacaatccttcaacttgttgaggctggccatcttctttggccagtg |
258 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
444 |
ccaacaacagttatactaaggttggatcctgtggattcagagtctgacaacgaaaacaatccttcaacttgttgaggctggccatcttctttggccaatg |
543 |
T |
|
| Q |
259 |
aac |
261 |
Q |
| |
|
||| |
|
|
| T |
544 |
aac |
546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 7242204 - 7242128
Alignment:
| Q |
99 |
tcatagaaaagagcaaagagtgctggaaaaatcttctttttggcaaggtctccagatgctccaacaacggttatact |
175 |
Q |
| |
|
|||||| |||| ||||| ||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
7242204 |
tcatagtaaagtgcaaaaagtgctggaaatatcttcttcttggcaaggtctccagaggctccaacaacagttatact |
7242128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University