View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12498_high_8 (Length: 255)
Name: NF12498_high_8
Description: NF12498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12498_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 34712324 - 34712555
Alignment:
| Q |
19 |
catcctactaaccttcattttctaaccacttctaggatgatgttaattttgagannnnnnn-agcagtagaggatataatttttattttgatgaagtcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34712324 |
catcctactaaccttcattttctaaccacttctaagatgatgttaattttgagattttttttaccagtagaggatataatttttattttgatgaagtctg |
34712423 |
T |
 |
| Q |
118 |
aatgttctttcgtagagaatataattcttattttgatgtagtttgaatgtcttttcaaatgccaaacaagtagttatccattttgaatgactagcttcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34712424 |
aatgttctttcgtagagaatataattcttattttgatgcagtttgaatgtcttttcaaatgccaaacaagtagttatccattttgaatgactagcttcta |
34712523 |
T |
 |
| Q |
218 |
aactatgttatgtggttatgtcagtgaacgag |
249 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| |
|
|
| T |
34712524 |
aactatgttatgtggttatgttagtaaacgag |
34712555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University