View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12499_high_5 (Length: 228)
Name: NF12499_high_5
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12499_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 45689891 - 45690089
Alignment:
| Q |
17 |
gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggctgtgagggtgagtgctgctagcaatggtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45689891 |
gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggccgtgagggtgagtgctgctagcaatggtga |
45689990 |
T |
 |
| Q |
117 |
cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttcttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45689991 |
cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttcttct |
45690089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University