View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12499_low_15 (Length: 228)

Name: NF12499_low_15
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12499_low_15
NF12499_low_15
[»] chr2 (1 HSPs)
chr2 (17-215)||(45689891-45690089)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 45689891 - 45690089
Alignment:
17 gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggctgtgagggtgagtgctgctagcaatggtga 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
45689891 gtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggccgtgagggtgagtgctgctagcaatggtga 45689990  T
117 cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttcttct 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45689991 cggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttcttct 45690089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University