View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12499_low_17 (Length: 210)
Name: NF12499_low_17
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12499_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 15702760 - 15702573
Alignment:
| Q |
11 |
agatggacatcacctttccaccacactccgtcgacatctttcagtttcttaattgcatttgctttcctcctctggtcggccttgctatggaaaatttttg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702760 |
agatggtcatcacctttccaccacactccgaagacatctttcagtttcttaattgcatttgttttcctcctctggtcggccttgctatggaaaatttttg |
15702661 |
T |
|
| Q |
111 |
tatttctatcaccatccttcaaccatactgccatacttctctgcctccacaaaacctcatctgttctcaacaggttgtctctctgctt |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15702660 |
tatttctatccccatccttcaaccatactgccctactcctctgcctccacaaaaccttatctgttctcaacaggttgtctctctgctt |
15702573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 129
Target Start/End: Complemental strand, 23378379 - 23378347
Alignment:
| Q |
97 |
atggaaaatttttgtatttctatcaccatcctt |
129 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
23378379 |
atggaaattttttgtatttctatcaccatcctt |
23378347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University