View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12499_low_18 (Length: 207)
Name: NF12499_low_18
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12499_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 60 - 199
Target Start/End: Original strand, 31713825 - 31713965
Alignment:
| Q |
60 |
aattagatcaggtggattgcttttaatctaacggtgaaattgagtggcccacgggtgagg-acttgttaaagccctcaccctagaatccaccctgtaaat |
158 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
31713825 |
aattagatcaggtgggttgcttttaatctaacggtgaaattgagtggtccacgggtgagggacttgttagaaccctcaccctagaatccaccctgtaaat |
31713924 |
T |
|
| Q |
159 |
tgttttctcaaatttcataaatttgttttctcagtgaacga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31713925 |
tgttttctcaaatttcataaatttgttttctcagtgaacga |
31713965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 60 - 150
Target Start/End: Original strand, 4879487 - 4879577
Alignment:
| Q |
60 |
aattagatcaggtggattgcttttaatctaacggtgaaattgagtggcccacgggtga-ggacttgttaaagccctcaccctagaatccacc |
150 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||| ||| |||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
4879487 |
aattagatcaggtaggttgcttttaatctaacggtgaaattgaatggtccacgggtgagggacttgttaga-acctcaccctagaatccacc |
4879577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 60 - 119
Target Start/End: Original strand, 25725766 - 25725824
Alignment:
| Q |
60 |
aattagatcaggtggattgcttttaatctaacggtgaaattgagtggcccacgggtgagg |
119 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||| |||||||| ||| |||| ||||||| |
|
|
| T |
25725766 |
aattagataaggtgg-ttgcttttaatctaacggcgaaattgaatggtccaccggtgagg |
25725824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University