View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12499_low_19 (Length: 206)
Name: NF12499_low_19
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12499_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 188
Target Start/End: Complemental strand, 6880552 - 6880381
Alignment:
| Q |
17 |
catcaatatatgaagttgttactggtgctgcaaagaaacaagttaaggagaagtcttcagtttcaaaccacagtggcagcaaatccaagtccagctcgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6880552 |
catcaatatatgaagttgttactggtgctgcaaagaaacaagttaaggagaagtcttcagtttcaaaccacagtggcagcaaatccaagtccagctcgaa |
6880453 |
T |
|
| Q |
117 |
agcggtaaataatatttttctgctctaacttatgcatgacaaaatatacatatattttttatacatacgtct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6880452 |
agcggtaaataatatttttctgctctaacttatgcatgacaaaatatacatatattttttatacatacgtct |
6880381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 27 - 129
Target Start/End: Original strand, 42660351 - 42660453
Alignment:
| Q |
27 |
tgaagttgttactggtgctgcaaagaaacaagttaaggagaagtcttcagtttcaaaccacagtggcagcaaatccaagtccagctcgaaagcggtaaat |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
42660351 |
tgaagttgttactggtgctgcaaagaaacaagtcaaagagaagtcttcagtctcaaacaacagtggcagcaaatctaagtccagttctaaagcggtaaat |
42660450 |
T |
|
| Q |
127 |
aat |
129 |
Q |
| |
|
||| |
|
|
| T |
42660451 |
aat |
42660453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University