View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_high_12 (Length: 341)
Name: NF1249_high_12
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 75 - 328
Target Start/End: Original strand, 40023134 - 40023387
Alignment:
| Q |
75 |
ttctcctccatctcaatacccattcttaagtgtaacttctcacccttacgtggccatggttgtttacatagatcctgata----cttccattttttgtta |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
40023134 |
ttctcctccatctcaatacccattcttaagtgtaacttctcacccttacatggccatggttgtttacatagatcctgatactcccttccattttcagtta |
40023233 |
T |
 |
| Q |
171 |
aagcaatgataaacctacacgatgtccaagcattcattaatgtctcaactagaagcctgattattattagcacacattttggttcatgtgtgtcgtcgta |
270 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40023234 |
aagcaatgacaaacctacacgatgtccaagcattcattaatgtctcgactagaagcctg---attattaggacacattttggttcatgtgtgtcgtcgta |
40023330 |
T |
 |
| Q |
271 |
accctagctcccctttgtcaccaaaatatgatcgatggtagcctatgtcatacccttc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40023331 |
accctagctcccctttgtcaccaaaata-gatcgatggtagcctatgtcataaccttc |
40023387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University