View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_high_17 (Length: 311)
Name: NF1249_high_17
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 12 - 154
Target Start/End: Original strand, 26245603 - 26245745
Alignment:
| Q |
12 |
ataggtagtgtttgtgtaataacgccttgttttggagcttgacgcgagtttcaaacaaaacaatggtatctcaagcgctatcagttcctgcaactcccac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26245603 |
ataggtagtgtttgtgtaataacgccttgttttggagcttgacgcgagtttcaaacaaaacaatggtatctcaagcgctatcagttcctgcaactcccac |
26245702 |
T |
 |
| Q |
112 |
cttcaccatcgcttctcacagaagaatcccttctaaactcgcg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26245703 |
cttcaccatcgcttctcacagaagaatcccttctcaactcgcg |
26245745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 219 - 286
Target Start/End: Original strand, 26245803 - 26245870
Alignment:
| Q |
219 |
gttaaaatctttataattgaattgcagaaacccttgcacgatagcttcttccttccaaagcccctatg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26245803 |
gttaaaatctttataattgaattgcagaaacccttgcacgatagcttcttccttccatagcccctatg |
26245870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University