View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_high_7 (Length: 412)
Name: NF1249_high_7
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 18 - 364
Target Start/End: Complemental strand, 52153370 - 52153025
Alignment:
| Q |
18 |
ctgtgtgtcatgtatcttgcattgtgaggctgcttcaagagtttggttgtgttttgttggcctgggcttaatttattgactccaacaaatttgtaaattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52153370 |
ctgtgtgtcatgtatcttgcattgtgaggttgcttcaagagtttggttgtgtttcgttggcctgggcttaatttattgactccaccaaatttgtaaattt |
52153271 |
T |
 |
| Q |
118 |
atttggtttggttgcatggggaaggtagaaataagaagctttgaagggnnnnnnnatactaatttggcattcaactatttgggtcgcggtttttgagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153270 |
atttggtttggttgcatggggaaggtagaaataagaagctttgaagggtttttt-atactaatttggcattcaactatttgggtcgcggtttttgagtgt |
52153172 |
T |
 |
| Q |
218 |
ttaaggaaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttctttcaagctgctgcctggtgtagtttggagttatcaatgccttgtt |
317 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153171 |
ttaagggaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttctttcaagctgctgcctggtgtagtttggagttatcaatgccttgtt |
52153072 |
T |
 |
| Q |
318 |
tttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153071 |
tttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
52153025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University