View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_101 (Length: 242)
Name: NF1249_low_101
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_101 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 44753859 - 44753715
Alignment:
| Q |
1 |
tgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcattttttccctttttgaagaggcgtaaaacctattccacttcatttcacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44753859 |
tgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcgttttttccctttttaaagaggcgtaaaacctattccacttcatttcacat |
44753760 |
T |
|
| Q |
101 |
ttcgtcgcttccgatccatccccttgcttactttccgcctttgat |
145 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44753759 |
ttcgtcgcttccgatccatcctcttgcttactttccgcctttgat |
44753715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 20502880 - 20502768
Alignment:
| Q |
1 |
tgtcttcgatcagctaaatttatgcgtcttcccgaggaattgttgtctcattttttc-cctttttgaagaggcgtaaaacctattcca-cttcatttcac |
98 |
Q |
| |
|
||||||||||| |||||| || ||||||||| |||||||| |||| |||||||| ||||||| |||||||||||||||||||| | |||||||| | |
|
|
| T |
20502880 |
tgtcttcgatccactaaatctacgcgtcttcctaaggaattgaagtcttattttttctcctttttaaagaggcgtaaaacctattctaccttcattt--c |
20502783 |
T |
|
| Q |
99 |
atttcgtcgcttccg |
113 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20502782 |
atttcgtcgcttccg |
20502768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University