View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_110 (Length: 221)
Name: NF1249_low_110
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_110 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 35902338 - 35902461
Alignment:
| Q |
1 |
ttggatgagacgatcgataagaaacaaaagaatatctttagagtactctggatgaccttggattcccataatatgatctccatatttaaacatctcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35902338 |
ttggatgagacgatcgataagaaacaaaagaatatctttagagtactctggatgaccttggattcccataatatgatctccatatttaaacatctcaatt |
35902437 |
T |
 |
| Q |
101 |
ccagttttatctgacctagcaatt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35902438 |
ccagttttatctgacctagcaatt |
35902461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 25 - 123
Target Start/End: Complemental strand, 37024571 - 37024473
Alignment:
| Q |
25 |
caaaagaatatctttagagtactctggatgaccttggattcccataatatgatctccatatttaaacatctcaattccagttttatctgacctagcaat |
123 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
37024571 |
caaaaggatgtctttagagtactcaggatgaccttgaattcccataatgtgatctccatatctaaacatctcaattccagtcttatctgatttagcaat |
37024473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University