View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_111 (Length: 221)
Name: NF1249_low_111
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 39979067 - 39978947
Alignment:
| Q |
1 |
tgcaagaaatgtaccaactgatgctggtttgaaggaccagaagaacttcatgacatttgctggtggttattctggaataggaaacaatggacttcctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39979067 |
tgcaagaaatgtaccaactgatgctggtttgaaggaccagaagaacttcatgacatttgctggtggttattctggaataggaaacaatggacttcctttt |
39978968 |
T |
|
| Q |
101 |
ggtggaattggaggtggaatc |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39978967 |
ggtggaattggaggtggaatc |
39978947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University