View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_128 (Length: 211)
Name: NF1249_low_128
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_128 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 6 - 128
Target Start/End: Complemental strand, 39962787 - 39962668
Alignment:
| Q |
6 |
ggatgtgggacttgtcaactttcattagccaaacaaacgaaaatagtgatggagcggttaacttccatcgattcaacaacatctctctctcacgccaagt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
39962787 |
ggatgtgggacttgtcaactttcattagccaaacaaacaaaaatagtgatggagcggttaacttccatcgattc---aacatctctctctcacgccgagt |
39962691 |
T |
|
| Q |
106 |
tttacgcacttactccctatgat |
128 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
39962690 |
tttacgcacttactctctatgat |
39962668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University