View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_139 (Length: 207)

Name: NF1249_low_139
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_139
NF1249_low_139
[»] chr5 (1 HSPs)
chr5 (4-131)||(7450043-7450170)
[»] chr4 (1 HSPs)
chr4 (1-54)||(3982885-3982938)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 4 - 131
Target Start/End: Original strand, 7450043 - 7450170
Alignment:
4 aggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttggactggttctctagccgtcctaagcaccatccaatcaccaatatgctccat 103  Q
    ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7450043 aggcgatgcaccttagtttgatggacgttcggtccacgtgtcaatgttggactggttctctagccgtcctaagcaccatccaatcaccaatatgctccat 7450142  T
104 ttaattgattcgttgacccacatattat 131  Q
    ||||||||||||||||| ||||||||||    
7450143 ttaattgattcgttgacgcacatattat 7450170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 3982885 - 3982938
Alignment:
1 ttcaggcgatgcaccttagtctgatggacgttcgatccacgtgtcaatgttgga 54  Q
    ||||||||||| |||||||| ||||||||||| | ||||| |||||| ||||||    
3982885 ttcaggcgatgtaccttagtttgatggacgtttggtccacatgtcaacgttgga 3982938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University