View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_140 (Length: 205)

Name: NF1249_low_140
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_140
NF1249_low_140
[»] chr1 (2 HSPs)
chr1 (54-122)||(12105091-12105159)
chr1 (1-41)||(12105597-12105637)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 54 - 122
Target Start/End: Complemental strand, 12105159 - 12105091
Alignment:
54 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgtt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12105159 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgtt 12105091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12105637 - 12105597
Alignment:
1 ggagatcatgaaagatgagagtgagatgttgaataatgaga 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
12105637 ggagatcatgaaagatgagagtgagatgttgaataatgaga 12105597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University