View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_144 (Length: 203)
Name: NF1249_low_144
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_144 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 168
Target Start/End: Complemental strand, 12649670 - 12649502
Alignment:
| Q |
7 |
aagaatatgaccaatagttgaaggcccaatatgcatggttataacttgtcacaacaagagtcaaga-------ggctgttcaaatcataataagaacttg |
99 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12649670 |
aagaaaatgaccaatagtttaaggcccaatatgcatggttatgacttgtcacaacaagagtcaagactcaagaggctgttcaaatcataataagaacttg |
12649571 |
T |
|
| Q |
100 |
agttcaccaatcaagatcaatcgtataggtatactgctaaacgtgtctaacaaatagggtgtgtaaaat |
168 |
Q |
| |
|
||||||||||| |||||||||||| || |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12649570 |
agttcaccaattaagatcaatcgtgtaagtatactgctgaacgtgtctaacaaatagggtgtgtaaaat |
12649502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University