View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_28 (Length: 365)
Name: NF1249_low_28
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 83 - 267
Target Start/End: Original strand, 31479292 - 31479476
Alignment:
| Q |
83 |
agcataggaccccaaagaaggagacaaggcgtgaagaatcaacagtaaccaatagacataccaatggacaaatttattattgaattcttaaggcagagac |
182 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479292 |
agcaaaggaccccaaagaaggagacaaggcgtgaagaatcaacagtaaccaatagccataccaatggacaaatttattattgaattcttaaggcagagac |
31479391 |
T |
|
| Q |
183 |
atgcatgtgccactgggactgccactgcccagtttacttacccacttatctttcacacatgacacatgcatggttaagtctatat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479392 |
atgcatgtgccactgggactgccactgcccagtttacttacccacttatctttcacacatgacacatgcatggttaagtctatat |
31479476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University