View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1249_low_34 (Length: 358)
Name: NF1249_low_34
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1249_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 2384990 - 2385108
Alignment:
| Q |
137 |
gtgttatcagttgagcaaacggtatgaaaattctgtcgtataacggcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtat |
236 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||| ||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2384990 |
gtgttatcagctgcgcgaacggtatgaaaattctgttgtataacggcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtat |
2385089 |
T |
 |
| Q |
237 |
cttgaaatttgaacctatg |
255 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2385090 |
cttgaaatttgaacctatg |
2385108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University